est2genome

 

Function

Align EST and genomic DNA sequences

Description

est2genome is a software tool to aid the prediction of genes by sequence homology. The program will align a set of spliced nucleotide sequences (ESTs cDNAs or mRNAs) to an unspliced genomic DNA sequence, inserting introns of arbitrary length when needed. In addition, where feasible introns start and stop at the splice consensus dinucleotides GT and AG.

Unless instructed otherwise, the program makes three alignments: First it compares both stands of the spliced sequence against the forward strand of the genomic, assuming the splice consensus GT/AG (ie in the forward gene direction). The maximum-scoring orientation is then realigned assuming the splice consensus CT/AC (ie in the reversed gene direction). Only the overall maximum-scoring alignment is reported.

The program outputs a list of the exons and introns it has found. The format is like that of MSPcrunch, ie a list of matching segments. This format is easy to parse into other software. The program also indicates, based on the splice site information, the gene's predicted direction of transcription. Optionally the full sequence alignment is printed as well (see the example).

Usage

Here is a sample session with est2genome.

% est2genome
Align EST and genomic DNA sequences
EST sequence(s): embl:hs989235
Genomic sequence: embl:hsnfg9
Output file [hs989235.est2genome]:

Command line arguments

   Mandatory qualifiers:
  [-est]               seqall     EST sequence(s)
  [-genome]            sequence   Genomic sequence
  [-outfile]           outfile    Output file name

   Optional qualifiers:
   -match              integer    Score for matching two bases
   -mismatch           integer    Cost for mismatching two bases
   -gappenalty         integer    Cost for deleting a single base in either
                                  sequence, excluding introns
   -intronpenalty      integer    Cost for an intron, independent of length.
   -splicepenalty      integer    Cost for an intron, independent of length
                                  and starting/ending on donor-acceptor sites
   -minscore           integer    Exclude alignments with scores below this
                                  threshold score.

   Advanced qualifiers:
   -reverse            boolean    Reverse the orientation of the EST sequence
   -[no]splice         boolean    Use donor and acceptor splice sites. If you
                                  want to ignore donor-acceptor sites then set
                                  this to be false.
   -mode               string     This determines the comparion mode. The
                                  default value is 'both', in which case both
                                  strands of the est are compared assuming a
                                  forward gene direction (ie GT/AG splice
                                  sites), and the best comparsion redone
                                  assuming a reversed (CT/AC) gene splicing
                                  direction. The other allowed modes are
                                  'forward', when just the forward strand is
                                  searched, and 'reverse', ditto for the
                                  reverse strand.
   -[no]best           boolean    You can print out all comparisons instead of
                                  just the best one by setting this to be
                                  false.
   -space              float      for linear-space recursion. If product of
                                  sequence lengths divided by 4 exceeds this
                                  then a divide-and-conquer strategy is used
                                  to control the memory requirements. In this
                                  way very long sequences can be aligned.
                                  If you have a machine with plenty of memory
                                  you can raise this parameter (but do not
                                  exceed the machine's physical RAM)
   -shuffle            integer    Shuffle
   -seed               integer    Random number seed
   -align              boolean    Show the alignment. The alignment includes
                                  the first and last 5 bases of each intron,
                                  together with the intron width. The
                                  direction of splicing is indicated by angle
                                  brackets (forward or reverse) or ????
                                  (unknown).
   -width              integer    Alignment width

   General qualifiers:
  -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose


Mandatory qualifiers Allowed values Default
[-est]
(Parameter 1)
EST sequence(s) Readable sequence(s) Required
[-genome]
(Parameter 2)
Genomic sequence Readable sequence Required
[-outfile]
(Parameter 3)
Output file name Output file <sequence>.est2genome
Optional qualifiers Allowed values Default
-match Score for matching two bases Any integer value 1
-mismatch Cost for mismatching two bases Any integer value 1
-gappenalty Cost for deleting a single base in either sequence, excluding introns Any integer value 2
-intronpenalty Cost for an intron, independent of length. Any integer value 40
-splicepenalty Cost for an intron, independent of length and starting/ending on donor-acceptor sites Any integer value 20
-minscore Exclude alignments with scores below this threshold score. Any integer value 30
Advanced qualifiers Allowed values Default
-reverse Reverse the orientation of the EST sequence Yes/No No
-[no]splice Use donor and acceptor splice sites. If you want to ignore donor-acceptor sites then set this to be false. Yes/No Yes
-mode This determines the comparion mode. The default value is 'both', in which case both strands of the est are compared assuming a forward gene direction (ie GT/AG splice sites), and the best comparsion redone assuming a reversed (CT/AC) gene splicing direction. The other allowed modes are 'forward', when just the forward strand is searched, and 'reverse', ditto for the reverse strand. Any string is accepted both
-[no]best You can print out all comparisons instead of just the best one by setting this to be false. Yes/No Yes
-space for linear-space recursion. If product of sequence lengths divided by 4 exceeds this then a divide-and-conquer strategy is used to control the memory requirements. In this way very long sequences can be aligned. If you have a machine with plenty of memory you can raise this parameter (but do not exceed the machine's physical RAM) Any numeric value 10.0
-shuffle Shuffle Any integer value 0
-seed Random number seed Any integer value 20825
-align Show the alignment. The alignment includes the first and last 5 bases of each intron, together with the intron width. The direction of splicing is indicated by angle brackets (forward or reverse) or ???? (unknown). Yes/No No
-width Alignment width Any integer value 50

Input file format

est2genome reads two nucleotide sequences. The first is an EST sequence (a single read or a finished cDNA). The second is a genomic finished sequence.

Output file format

MSP type segments

There are four types of segment,
  1. each gapped Exon
  2. each Intron (marked with a ? if it does not start GT and end AG)
  3. the complete alignment Span
  4. individual ungapped matching Segments.
In the above example:

Type     score    %  gstart gstop genome estart estop EST EST doc

Note Best alignment is between forward est and forward genome, but splice  sites imply REVERSED GENE
Exon       163  91.8 25685 25874 HSNFG9   1 193 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
-Intron    -20   0.0 25875 26278 HSNFG9
Exon       207  98.1 26279 26492 HSNFG9 194 407 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
-Intron    -20   0.0 26493 27390 HSNFG9
Exon        63  86.4 27391 27476 HSNFG9 408 494 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...

Span       393  93.6 25685 27476 HSNFG9   1 494 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...

Segment     14  83.3 25685 25702 HSNFG9   1  18 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     28  85.7 25703 25737 HSNFG9  20  54 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment      4 100.0 25738 25741 HSNFG9  56  59 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     13 100.0 25742 25754 HSNFG9  61  73 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment      4 100.0 25756 25759 HSNFG9  74  77 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment    110  97.4 25760 25874 HSNFG9  79 193 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     37 100.0 26279 26315 HSNFG9 194 230 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment    162  98.8 26317 26480 HSNFG9 231 394 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     12 100.0 26481 26492 HSNFG9 396 407 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     16 100.0 27391 27406 HSNFG9 408 423 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     10  91.7 27407 27418 HSNFG9 425 436 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     19  95.2 27419 27439 HSNFG9 438 458 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...
Segment     24  80.6 27441 27476 HSNFG9 459 494 HS989235 yo13c02.s1 Soares adult brain N2b5HB55Y ...

The score for Exon segments is the alignment score excluding flanking intron penalties. The Span score is the total including the intron costs.

The coordinates of the genomic sequence always refer to the positive strand, but are swapped if the est has been reversed. The splice direction of Introns are indicated as +Intron (forward, splice sites GT/AG) or -Intron (reverse, splice sites CT/AC), or ?Intron (unknown direction). Segment entries give the alignment as a series of ungapped matching segments.

Full alignment

You get the alignment if the -align switch is set. The alignment includes the first and last 5 bases of each intron, together with the intron width. The direction of splicing is indicated by >>>> (forward) or <<<< (reverse) or ???? (unknown):

HSNFG9 vs HS989235:

  HSNFG9  25685 cccggaagctcatcttgg-ccaccgactctcgcttgcgccgccgcgggag  25733
                || | ||||||| ||||| |||||||||||||  ||   |||||||||||
HS989235      1 ccggnaagctcancttggaccaccgactctcgantgnntcgccgcgggag     50

  HSNFG9  25734 ccgg-tgga-aacctgagcgggagctgg-agaaggagcagagggaggcag  25780
                |||| |||| ||||||||||||| |||| |||||||||||||||||||||
HS989235     51 ccggntgganaacctgagcggga-ctggnagaaggagcagagggaggcag     99

  HSNFG9  25781 cacccggcgtgacgggagtgtgtggggcactcaggccttccgcagtgtca  25830
                ||||||||||||||| ||||||||||||||||||||||||||||||||||
HS989235    100 cacccggcgtgacggnagtgtgtggggcactcaggccttccgcagtgtca    149

  HSNFG9  25831 tctgccacacggaaggcacggccacgggccagggggtctatgatctgga.  25874
                |||||||||||||||||||||||||||||  |||||||||||||<<<<< 
HS989235    150 tctgccacacggaaggcacggccacgggcaggggggtctatgat......    193

  HSNFG9  25874 ....cataccttctgcatgcccagctggcatggccccacgtagagtgggg  26319
                404 <<<<<||||||||||||||||||||||||||||||||||||| || 
HS989235    193 .........cttctgcatgcccagctggcatggccccacgtagagt-ggn    233

  HSNFG9  26320 gtggcgtctcggtgctggtcagcgacacgttgtcctggctgggcaggtcc  26369
                 |||||||||||||||||||||||||||||||||||||||||||||||||
HS989235    234 ntggcgtctcggtgctggtcagcgacacgttgtcctggctgggcaggtcc    283

  HSNFG9  26370 agctcccggaggacctggggcttcagcttcccgtagcgctggctgcagtg  26419
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HS989235    284 agctcccggaggacctggggcttcagcttcccgtagcgctggctgcagtg    333

  HSNFG9  26420 acggatgctcttgcgctgccatttctgggtgctgtcactgtccttgctca  26469
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HS989235    334 acggatgctcttgcgctgccatttctgggtgctgtcactgtccttgctca    383

  HSNFG9  26470 ctccaaaccag-tcggcggtccccctggc.....ggtacctgcggatggt  27401
                ||||||||||| ||||||||||||<<<<< 898 <<<<<|||||||||||
HS989235    384 ctccaaaccagttcggcggtcccc...............ctgcggatggt    418

  HSNFG9  27402 ctgtg-tgatggacgtct-ggcgttgcagcaccggccgccggagctcatg  27449
                ||||| |||||||||| | ||| ||||||||||||||||| ||| |||||
HS989235    419 ctgtgttgatggacgtttgggctttgcagcaccggccgcc-gagttcatg    467

  HSNFG9  27450 gtggggtgaagagatgtgggctgtctc  27476
                || |||| ||||||| |||| | | ||
HS989235    468 gtngggtnaagagatttgggttttttc    494


Alignment Score: 393

In this example there are two reverse introns, of lengths 404 and 898 bp.

Data files

Notes

est2genome uses a linear-space dynamic-programming algorithm. It has the following parameters:
parameter               default         description

match                   1               score for matching two bases
mismatch                1               cost for mismatching two bases
gap_penalty             2               cost for deleting a single base in
                                        either sequence, 
                                        excluding introns
intron_penalty          40              cost for an intron, independent of
                                        length.
splice_penalty          20              cost for an intron, independent of
                                        length and starting/ending on
                                        donor-acceptor sites.

space                   10              Space threshold (in  megabytes) 
                                        for linear-space recursion. If the
                                        product of the two sequence 
                                        lengths divided by 4 exceeds this then
                                        a divide-and-conquer strategy is used 
                                        to control the memory requirements. 
                                        In this way very long sequences can
                                        be aligned. 
                                        If you have a machine with plenty of
                                        memory you can raise this parameter
                                        (but do not exceed the machine's
                                        physical RAM)
                                        However, normally you should not need
                                        to change this parameter.
There is no gap initiation cost for short gaps, just a penalty proportional to the length of the gap. Thus the cost of inserting a gap of length L in the EST is
 L*gap_penalty 
and the cost in the genome is
 
min { L*gap_penalty, intron_penalty } or
min { L*gap_penalty, splice_penalty } if the gap starts with GT and ends with AG
                                     (or CT/AC if splice direction reversed)
Introns are not allowed in the EST. The difference between the intron_penalty and splice_penalty allows for some slack in marking the intron end-points. It is often the case that the best intron boundaries, from the point of view of minimising mismatches, will not coincide exactly with the splice consensus, so provided the difference between the intron/splice penalties outweighs the extra mismatch/indel costs the alignment will respect the proper boundaries. If the alignment still prefers boundaries which don't start and end with the splice consensus then this may indicate errors in the sequences.

The default parameters work well, except for very short exons (length less than the splice_penalty, approx) which may be skipped. The intron penalties should not be set to less that the maximum expected random match between the sequences (typically 10-15 bp) in order to avoid spurious matches. The algorithm has the following steps:

  1. A first-pass Smith-Waterman scan is done to locate the score, start and end of the maximal scoring segment (including introns of course). No other alignment information is retained.
  2. Subsequences corresponding to the maximal-scoring segments are extracted. If the product of these subsequences' lengths is less than the area parameter then the segments are re-aligned using the Needleman-Wunsch algorithm, which in this instance will give the same result as the Smith-Waterman since they are guaranteed to align end-to-end.
  3. If the product of lengths exceeds the area threshold then the alignment is recursively broken down by splitting the EST in half and finding the genome position which aligns with the EST mid-point. The problem then reduces to aligning the left-hand and right-hand portions of the sequences separately and merging the result.
The worst-case run-time for the algorithm is about 3 times as long as would be taken to align using a quadratic-space program. In practice the maximal-scoring segment is often much shorter than the full genome length so the program runs only about 1.5 times slower.

References

Mott, R (19) CABIOS.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It return 0 unless an error occurs.

Known bugs

None.

See also

Program nameDescription
alignwrapAligns a set of sequences to a seed alignment
needleNeedleman-Wunsch global alignment
stretcherFinds the best global alignment between two sequences

Author(s)

This application was modified for inclusion in EMBOSS by Peter Rice (pmr@sanger.ac.uk) Informatics Division, The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.

The original program was est_genome, written by Richard Mott at the Sanger Centre. The original version is available from ftp://ftp.sanger.ac.uk/pub/pmr/est_genome.4.tar.Z

History

Finished.

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

Thu, 29 Mar 2001

I found est2genome having problems finding very short exons with the default parameters.

With the folowing changes it detects also a 14bp exon correctly:

mismatch 1 -> 3
intronpenalty 40 -> 20
splicepenalty 20 -> 10
minscore 30 -> 10
Dr. David Bauer
GenProfile AG, Max-Delbrueck-Center, Erwin-Negelein-Haus 
Robert-Roessle-Str. 10, D-13125 Berlin, Germany
bauer@genprofile.com, Tel:49-30-94892165, FAX:49-30-94892151