![]() |
wordfinder |
Please help by correcting and extending the Wiki pages.
% wordfinder tembl:j01636 @eclac.list -word 50 Match large sequences against one or more other sequences Gap opening penalty [30.0]: Gap extension penalty [1.5]: 3.0 Output alignment [j01636.wordfinder]: |
Go to the input files for this example
Go to the output files for this example
Match large sequences against one or more other sequences Version: EMBOSS:6.2.0 Standard (Mandatory) qualifiers: [-asequence] seqset Sequence set filename and optional format, or reference (input USA) [-bsequence] seqall Sequence(s) filename and optional format, or reference (input USA) -gapopen float [10.0 for any sequence type] Gap opening penalty (Number from 0.000 to 1000.000) -gapextend float [0.5 for any sequence type] Gap extension penalty (Number from 0.000 to 10.000) [-outfile] align [*.wordfinder] Output alignment file name Additional (Optional) qualifiers: -datafile matrixf [EBLOSUM62 for protein, EDNAFULL for DNA] This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. -width integer [16] Alignment width (Integer 1 or more) -wordlen integer [6] Word length for initial matching (Integer 3 or more) -limitmatch integer [0] Maximum match score (zero for no limit) (Integer 0 or more) -limitalign integer [0] Maximum alignment length (zero for no limit) (Integer 0 or more) -lowmatch integer [0] Minimum match score (zero for no limit) (Integer 0 or more) -lowalign integer [0] Minimum alignment length (zero for no limit) (Integer 0 or more) -errorfile outfile [wordfinder.error] Error file to be written to Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-asequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-bsequence" associated qualifiers -sbegin2 integer Start of each sequence to be used -send2 integer End of each sequence to be used -sreverse2 boolean Reverse (if DNA) -sask2 boolean Ask for begin/end/reverse -snucleotide2 boolean Sequence is nucleotide -sprotein2 boolean Sequence is protein -slower2 boolean Make lower case -supper2 boolean Make upper case -sformat2 string Input sequence format -sdbname2 string Database name -sid2 string Entryname -ufo2 string UFO features -fformat2 string Features format -fopenfile2 string Features file name "-outfile" associated qualifiers -aformat3 string Alignment format -aextension3 string File name extension -adirectory3 string Output directory -aname3 string Base file name -awidth3 integer Alignment width -aaccshow3 boolean Show accession number in the header -adesshow3 boolean Show description in the header -ausashow3 boolean Show the full USA in the alignment -aglobal3 boolean Show the full sequence in alignment "-errorfile" associated qualifiers -odirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-asequence] (Parameter 1) |
seqset | Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required |
[-bsequence] (Parameter 2) |
seqall | Sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
-gapopen | float | Gap opening penalty | Number from 0.000 to 1000.000 | 10.0 for any sequence type |
-gapextend | float | Gap extension penalty | Number from 0.000 to 10.000 | 0.5 for any sequence type |
[-outfile] (Parameter 3) |
align | Output alignment file name | Alignment output file | <*>.wordfinder |
Additional (Optional) qualifiers | ||||
-datafile | matrixf | This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. | Comparison matrix file in EMBOSS data path | EBLOSUM62 for protein EDNAFULL for DNA |
-width | integer | Alignment width | Integer 1 or more | 16 |
-wordlen | integer | Word length for initial matching | Integer 3 or more | 6 |
-limitmatch | integer | Maximum match score (zero for no limit) | Integer 0 or more | 0 |
-limitalign | integer | Maximum alignment length (zero for no limit) | Integer 0 or more | 0 |
-lowmatch | integer | Minimum match score (zero for no limit) | Integer 0 or more | 0 |
-lowalign | integer | Minimum alignment length (zero for no limit) | Integer 0 or more | 0 |
-errorfile | outfile | Error file to be written to | Output file | wordfinder.error |
Advanced (Unprompted) qualifiers | ||||
(none) | ||||
Associated qualifiers | ||||
"-asequence" associated seqset qualifiers | ||||
-sbegin1 -sbegin_asequence |
integer | Start of each sequence to be used | Any integer value | 0 |
-send1 -send_asequence |
integer | End of each sequence to be used | Any integer value | 0 |
-sreverse1 -sreverse_asequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask1 -sask_asequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide1 -snucleotide_asequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein1 -sprotein_asequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower1 -slower_asequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper1 -supper_asequence |
boolean | Make upper case | Boolean value Yes/No | N |
-sformat1 -sformat_asequence |
string | Input sequence format | Any string | |
-sdbname1 -sdbname_asequence |
string | Database name | Any string | |
-sid1 -sid_asequence |
string | Entryname | Any string | |
-ufo1 -ufo_asequence |
string | UFO features | Any string | |
-fformat1 -fformat_asequence |
string | Features format | Any string | |
-fopenfile1 -fopenfile_asequence |
string | Features file name | Any string | |
"-bsequence" associated seqall qualifiers | ||||
-sbegin2 -sbegin_bsequence |
integer | Start of each sequence to be used | Any integer value | 0 |
-send2 -send_bsequence |
integer | End of each sequence to be used | Any integer value | 0 |
-sreverse2 -sreverse_bsequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask2 -sask_bsequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide2 -snucleotide_bsequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein2 -sprotein_bsequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower2 -slower_bsequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper2 -supper_bsequence |
boolean | Make upper case | Boolean value Yes/No | N |
-sformat2 -sformat_bsequence |
string | Input sequence format | Any string | |
-sdbname2 -sdbname_bsequence |
string | Database name | Any string | |
-sid2 -sid_bsequence |
string | Entryname | Any string | |
-ufo2 -ufo_bsequence |
string | UFO features | Any string | |
-fformat2 -fformat_bsequence |
string | Features format | Any string | |
-fopenfile2 -fopenfile_bsequence |
string | Features file name | Any string | |
"-outfile" associated align qualifiers | ||||
-aformat3 -aformat_outfile |
string | Alignment format | Any string | simple |
-aextension3 -aextension_outfile |
string | File name extension | Any string | |
-adirectory3 -adirectory_outfile |
string | Output directory | Any string | |
-aname3 -aname_outfile |
string | Base file name | Any string | |
-awidth3 -awidth_outfile |
integer | Alignment width | Any integer value | 0 |
-aaccshow3 -aaccshow_outfile |
boolean | Show accession number in the header | Boolean value Yes/No | N |
-adesshow3 -adesshow_outfile |
boolean | Show description in the header | Boolean value Yes/No | N |
-ausashow3 -ausashow_outfile |
boolean | Show the full USA in the alignment | Boolean value Yes/No | N |
-aglobal3 -aglobal_outfile |
boolean | Show the full sequence in alignment | Boolean value Yes/No | N |
"-errorfile" associated outfile qualifiers | ||||
-odirectory | string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
#Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 |
ID J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP. XX AC J01636; J01637; K01483; K01793; XX DT 30-NOV-1990 (Rel. 26, Created) DT 09-SEP-2004 (Rel. 81, Last updated, Version 8) XX DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes. XX KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon; KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene; KW lacZ gene; mutagenesis; palindrome; promoter region; KW thiogalactoside acetyltransferase. XX OS Escherichia coli OC Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; OC Enterobacteriaceae; Escherichia. XX RN [1] RP 1243-1266 RX DOI; 10.1073/pnas.70.12.3581. RX PUBMED; 4587255. RA Gilbert W., Maxam A.; RT "The nucleotide sequence of the lac operator"; RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973). XX RN [2] RP 1246-1308 RX DOI; 10.1073/pnas.70.12.3585. RX PUBMED; 4587256. RA Maizels N.M.; RT "The nucleotide sequence of the lactose messenger ribonucleic acid RT transcribed from the UV5 promoter mutant of Escherichia coli"; RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973). XX RN [3] RX PUBMED; 4598642. RA Gilbert W., Maizels N., Maxam A.; RT "Sequences of controlling regions of the lactose operon"; RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974). XX RN [4] RA Gilbert W., Gralla J., Majors A.J., Maxam A.; RT "Lactose operator sequences and the action of lac repressor"; RL (in) Sund H., Blauer G. (Eds.); RL PROTEIN-LIGAND INTERACTIONS:193-207; RL Walter de Gruyter, New York (1975) XX RN [5] RP 1146-1282 [Part of this file has been deleted for brevity] cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560 ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620 ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680 ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740 gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800 aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860 gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920 ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980 cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040 agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100 gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160 ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220 ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280 ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340 cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400 tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460 tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520 atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580 gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640 gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700 caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760 gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820 taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880 aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940 acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000 atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060 ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120 taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180 tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240 tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300 attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360 ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420 gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480 gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540 atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600 atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660 gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720 accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780 agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840 ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900 tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960 taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020 acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080 caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140 tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200 gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260 ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320 cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380 actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440 cagcccgccc atggtaacca ccggcagagc ggtcgac 7477 // |
The output is a standard EMBOSS alignment file.
The results can be output in one of several styles by using the command-line qualifier -aformat xxx, where 'xxx' is replaced by the name of the required format. Some of the alignment formats can cope with an unlimited number of sequences, while others are only for pairs of sequences.
The available multiple alignment format names are: unknown, multiple, simple, fasta, msf, trace, srs
The available pairwise alignment format names are: pair, markx0, markx1, markx2, markx3, markx10, srspair, score
See: http://emboss.sf.net/docs/themes/AlignFormats.html for further information on alignment formats.
The output alignment is in simple format by default.
Target 1 J01636 matches 1 Target 2 X51872 matches 1 Target 3 V00294 matches 1 Target 4 V00295 matches 1 Target 5 V00296 matches 1 |
######################################## # Program: wordfinder # Rundate: Fri 15 Jan 2010 12:00:00 # Commandline: wordfinder # [-asequence] tembl:j01636 # [-bsequence] @../../data/eclac.list # -wordlen 50 # -gapextend 3.0 # Align_format: simple # Report_file: j01636.wordfinder ######################################## #======================================= # # Aligned_sequences: 2 # 1: J01636 # 2: J01636 # Matrix: EDNAFULL # Gap_penalty: 30.0 # Extend_penalty: 3.0 # # Length: 7477 # Identity: 7477/7477 (100.0%) # Similarity: 7477/7477 (100.0%) # Gaps: 0/7477 ( 0.0%) # Score: 37385.0 # # Wordscore:7477 # Alignlength:7477 # #======================================= J01636 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50 |||||||||||||||||||||||||||||||||||||||||||||||||| J01636 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50 J01636 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100 |||||||||||||||||||||||||||||||||||||||||||||||||| J01636 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100 J01636 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150 |||||||||||||||||||||||||||||||||||||||||||||||||| J01636 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150 J01636 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200 |||||||||||||||||||||||||||||||||||||||||||||||||| J01636 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200 J01636 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250 |||||||||||||||||||||||||||||||||||||||||||||||||| [Part of this file has been deleted for brevity] J01636 3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 3836 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 2550 J01636 3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 3886 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 2600 J01636 3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 3936 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 2650 J01636 3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 3986 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 2700 J01636 3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 4036 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 2750 J01636 4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 4086 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 2800 J01636 4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 4136 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 2850 J01636 4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 4186 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 2900 J01636 4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 4236 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 2950 J01636 4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 4286 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 3000 J01636 4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 4336 |||||||||||||||||||||||||||||||||||||||||||||||||| V00296 3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 3050 J01636 4337 gttggtctggtgtcaaaaataataataa 4364 |||||||||||||||||||||||||||| V00296 3051 gttggtctggtgtcaaaaataataataa 3078 #--------------------------------------- #--------------------------------------- |
The file 'wordfinder.error' will contain any errors that occured during the program. This may be that wordmatch could not find any matches hence no suitable start point is found for the smith-waterman calculation.
EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".
The directories are searched in the following order:
Because it does a Smith & Waterman alignment (albeit in a narrow region around the diagonal shown to be the 'best' by a word match), this program can use huge amounts of memory if the sequences are large.
Because the alignment is made within a narrow area each side of the 'best' diagonal, if there are sufficient indels between the two sequences, then the path of the Smith & Waterman alignment can wander outside of this area. Making the width larger can avoid this problem, but you then use more memory.
The longer the sequences and the wider the specified alignment width, the more memory will be used.
If the program terminates due to lack of memory you can try the following:
Run the UNIX command 'limit' to see if your stack or memory usage have been limited and if so, run 'unlimit', (e.g.: '% unlimit stacksize').
Program name | Description |
---|---|
matcher | Waterman-Eggert local alignment of two sequences |
seqmatchall | All-against-all word comparison of a sequence set |
supermatcher | Calculate approximate local pair-wise alignments of larger sequences |
water | Smith-Waterman local alignment of sequences |
wordmatch | Finds regions of identity (exact matches) of two sequences |